Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-551a URS00002E99CB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-551a: Hsa-mir-551a is a microRNA that has been the subject of research to determine its potential as a surrogate marker for tissue status and its association with a lower risk of certain cancers and better prognosis in regular walnut consumers [PMC9003099]. The study found that age, sex, hsa-miR-485-3p, hsa-miR-486-5p, hsa-miR-933, hsa-mir-551a, and hsa-miR-1224-5p were independent predictors [PMC8478533]. However, further research is needed to confirm whether serum concentrations of hsa-mir-551a accurately reflect its status in tissues [PMC9003099]. Additionally, the study suggests that the upregulation of hsa-mir-551a following walnut consumption may be mechanistically linked to a lower risk of certain cancers and better prognosis in regular walnut consumers [PMC9003099]. These findings highlight the potential role of hsa-mir-551a as a biomarker for cancer risk assessment and prognosis evaluation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGACCCACUCUUGGUUUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Canis lupus familiaris cfa-miR-551a
  2. Equus caballus (horse) eca-miR-551a
  3. Gorilla gorilla gorilla ggo-miR-551a (MIR551A)
  4. Gorilla gorilla (western gorilla) ggo-miR-551a
  5. Macaca mulatta (Rhesus monkey) mml-miR-551a
  6. Pan troglodytes (chimpanzee) ptr-miR-551a
  7. Pongo pygmaeus ppy-miR-551a
  8. Python bivittatus (Burmese python) Pbv-Mir-551-P1_3p (mature (guide))
Publications