Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548p URS00002E628F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548p: Hsa-mir-548p is a miRNA molecule that is reported in the miRCancer dataset [PMC7582694]. The variant allele of rs221636 has been found to potentially affect the targeting of hsa-mir-548p to the 3'UTR of Lin28B in oral cancer cells [PMC5378942]. Transfections were performed with cells using Lipofectamine2000, and luciferase plasmids with different rs221636 alleles were co-transfected into different cells with synthesized mature hsa-mir-548p mimic [PMC5378942]. It is hypothesized that rs221636 might affect the expression of Lin28B by disturbing the binding of hsa-mir-548p and the let-7/Lin28 double-negative feedback loop [PMC5378942]. In silico analysis tools were used to predict that rs221636 is located at the target site of hsa-mir-548p [PMC5378942]. Another study found that rs221636 might affect the risk of oral cavity cancer by disturbing interactions between other miRNAs, such as hsa-mir-548p, and Lin28B [PMC5378942]. Hsa-mir-548p has been identified as one of the top six miRNAs with a high number of target mRNAs [PMC9421250]. It has also been identified as one of several miRNAs affected by rare CNVs in CAKUT, a congenital anomaly affecting kidney and urinary tract development [PMC9587983]. Hsa-mir-548p has also been collected in a study investigating its role in AML pathogenesis and its interaction with YY1, a prominent feature regulator implicated in AML development [PMC4207489].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAAAAACUGCAGUUACUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Callithrix jacchus cja-miR-548v
  2. Pan troglodytes ptr-miR-548p
Publications