Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Drosophila melanogaster. Annotated by 5 databases (RefSeq, FlyBase, Rfam, ENA, miRBase). Matches 1 Rfam family (mir-303, RF03959). Drosophila melanogaster (fruit fly) microRNA dme-mir-303 precursor sequence is a product of 303 precursor RN, mir-303, 303 precursor RNA, FBgn0262390, 303, mir-303 precursor RNA, mir-303 microRNA precursor family, 303 microRNA precursor famil, mir-303 precursor, mir-303 precurso, 303 microRNA precursor family, dme-mir-303 precursor genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UCUUGGUUUAGGUUUCACAGGAAACUGGUUUAAUAACGAAAACUAGUUUCCUCUAAAAUCCUAAUCAAGA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.