Oryza sativa (Asian cultivated rice) osa-miR167d-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR167d-3p URS00002E3FC8_4530

22 nucleotides
1 database (miRBase)
Found in 3 other species
4 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GAUCAUGCUGUGCAGUUUCAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Brachypodium distachyon (stiff brome) bdi-miR167c-3p
Oryza sativa Japonica Group microRNA osa-miR167d-3p
Zea mays (maize) zma-miR167e-3p

Publications