Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-34c precursor URS00002E303C_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-34c: Bta-mir-34c is a microRNA that has been studied in various contexts [PMC7214931]. It has been found to be differentially expressed between fresh and frozen sperm [PMC7214931]. In one study, bta-mir-34c was selected for RT-qPCR validation to investigate the credibility of high-throughput sequencing [PMC6876490]. It was predicted that bta-mir-34c could bind to and regulate the expression of DDIT4 [PMC6876490]. Additionally, bta-mir-34c was confirmed to be downregulated in different studies [PMC6876490][PMC6949159][PMC9581129]. It was found to share targets with other miRNAs, such as ACAD10, PYCR1, and CLDN2 [PMC6876490]. DDIT4 was identified as a target shared by bta-mir-34c and another miRNA, bta-miR-449b [PMC6876490]. Bta-mir-34c has been implicated in cell transformation induced by BPV E5 and is involved in cancer progression and angiogenesis through the regulation of PYCR1 and DDIT4 [PMC6876490]. Technical validation of miRNA-seq data has been performed using RT-qPCR on bta-miR-100 and bta-mir-34c, which are highly expressed in bull spermatozoa [PMC9581129][PMC6731312]. Bta-mir-34c is significantly downregulated in cattle-yak testis and plays a role in promoting the transition of spermatogonia from mitosis to meiosis [PMC9785434][PMC7312616].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAAUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications