Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-545-3p URS00002E1509_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-545: Hsa-mir-545 is a microRNA that has been studied in various contexts. In a study on breast cancer prognosis, hsa-mir-545 was found to be significantly up-regulated in breast cancer tissues compared to normal tissues [PMC8004706]. Another study on myocardial infarction found that hsa-mir-545 downregulates the expression of SLC7A2 mRNA [PMC7764698]. In ovarian cancer, hsa-mir-545 was found to be predominantly expressed in patients with wild-type BRCA1/2 ovarian cancers who may benefit from platinum-based chemotherapy [PMC4522283]. Additionally, hsa-mir-545 was identified as one of the four candidate microRNAs that target the IL12B 3′UTR sequence, which is located proximally to A+1188C [PMC3470565]. Furthermore, a risk score calculation using multiple miRNAs including hsa-mir-545 showed promising results in predicting prognosis in breast cancer patients [PMC8176021]. Overall, these studies highlight the potential role of hsa-mir-545 as a biomarker and therapeutic target in various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGCAAACAUUUAUUGUGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Macaca mulatta (Rhesus monkey) mml-miR-545
  2. Pan troglodytes ptr-miR-545
  3. Pongo pygmaeus (Bornean orangutan) ppy-miR-545
Publications