Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 21 (SNORD21) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 21 (SNORD21) URS00002E0A2C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD21: SNORD21 is a small nucleolar RNA (snoRNA) that has been identified as a potential predictive biomarker for prognosis in colorectal cancer (CRC) patients [PMC6629867]. In studies analyzing miRNAs and mRNAs, the Ct values of SNORD21, along with 18S and cel-miR-39-3p, were used as covariates [PMC8061690]. SNORD21 has also been used as an internal control in miRNA analyses, along with cel-miR-39-3p and 18S [PMC8061690]. In CRC patients, SNORD21 displayed significant upregulation along with other genes such as VPS36, CDC5L, ST7-OT4, and RPL5 [PMC9279823]. It has also been used as a housekeeping control in studies involving 18S [PMC8241840]. SNORD21 was identified as one of the differentially expressed snoRNAs in synovial fluid and plasma samples from an ageing/osteoarthritis study [PMC9393553]. Additionally, small RNAs derived from SNORD21 have shown miRNA activity [PMC4408801]. In various studies involving different genes and RNA types (snoRNAs and small nuclear RNAs), SNORD21 has been mentioned for its role or presence [PMC8606581] [PMC7072903] [PMC3891868] [PMC4159348]. Overall, SNORD21 is a snoRNA that has shown potential as a predictive biomarker for prognosis in CRC patients. It has also been used as an internal control or housekeeping control in various analyses involving miRNAs and mRNAs. Additionally, it has been identified as one of the differentially expressed snoRNAs in synovial fluid and plasma samples. Furthermore, small RNAs derived from SNORD21 have demonstrated miRNA activity. SNORD21 has been mentioned in studies involving different genes and RNA types.

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGAAUGAUGAUAUCCCACUAACUGAGCAGUCAGUAGUUGGUCCUUUGGUUGCAUAUGAUGCGAUAAUUGUUUCAAGACGGGACUGAUGGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

2D structure Publications