Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C RNA of Unknown Function URS00002DAFB5_559292

  • 710 nucleotides
  • 3 databases (ENA, RefSeq, SGD)
  • Found in 16 species
  • ncRNA

Automated summary: This sRNA sequence is 710 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (SGD, RefSeq, ENA). Described in 5 papers. Saccharomyces cerevisiae S288C RNA of Unknown Function sequence is a product of RUF5-1, RUF5-2 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACAAAGUAUCUAAACAAAAUACAUAAGUGUACUCAAACUGAGUAGAAUCGUCGAUUAAACUUCCUUCUCCUUUUAAAAAUUAAAAACAGCAAAUAGUUAGAUGAAUAUAUUAAAGACUAUUCGUUUCAUUUCCCAGAGCAGCAUGACUUCUUGGUUUCUUCAGACUUGUUACCGCAGGGGCAUUUGUCGUCGCUGUUACACCCCGUUGGGCAGCUACAUGAUUUUUGGCAUUGUUCAUUAUUUUUGCAGCUACCACAUUGGCAUUGGCACUCAUGACCUUCAUUUUGGAAGUUAAUUAAUUCGCUGAACAUUUUAUGUGAUGAUUGAUUGAUUGAUUGUACAGUUUGUUUUUCUUAAUAUCUAUUUCGAUGACUUCUAUAUGAUAUUGCACUAACAAGAAGAUAUUAUAAUGCAAUUGAUACAAGACAAGGAGUUAUUUGCUUCUCUUUUAUAUGAUUCUGACAAUCCAUAUUGCGUUGGUAGUCUUUUUUGCUGGAACGGUUCAGCGGAAAAGACGCAUCGCUCUUUUUGCUUCUAGAAGAAAUGCCAGCAAAAGAAUCUCUUGACAGUGACUGACAGCAAAAAUGUCUUUUUCUAACUAGUAACAAGGCUAAGAUAUCAGCCUGAAAUAAAGGGUGGUGAAGUAAUAAUUAAAUCAUCCGUAUAAACCUAUACACAUAUAUGAGGAAAAAUAAUACAAAAGUGUUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Saccharomyces cerevisiae RUF5-1
    2. Saccharomyces cerevisiae YJM1133 RUF5-2
    3. Saccharomyces cerevisiae YJM1208 RUF5-1
    4. Saccharomyces cerevisiae YJM1250 RUF5-1
    5. Saccharomyces cerevisiae YJM1383 RUF5-2
    6. Saccharomyces cerevisiae YJM1385 RUF5-2
    7. Saccharomyces cerevisiae YJM1386 RUF5-2
    8. Saccharomyces cerevisiae YJM1443 RUF5-2
    9. Saccharomyces cerevisiae YJM1615 RUF5-2
    10. Saccharomyces cerevisiae YJM428 RUF5-1
    11. Saccharomyces cerevisiae YJM541 RUF5-2
    12. Saccharomyces cerevisiae YJM682 RUF5-2
    13. Saccharomyces cerevisiae YJM683 RUF5-1
    14. Saccharomyces cerevisiae YJM689 RUF5-1