Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-202-5p URS00002DA4FF_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-202: Mmu-mir-202 is a microRNA that is found within the second exon of the lncRNA AK144366, which is down-regulated in neonatal testis [PMC3794988]. This suggests that AK144366 may be the primary precursor to mmu-mir-202 [PMC3794988]. Mmu-mir-202 expression is up-regulated in neonatal testis and down-regulated in adult testis, indicating its potential role in testicular development [PMC3794988]. Mmu-mir-202 has been shown to be one of the small subset of microRNAs found in mitochondria, suggesting its association with mitochondrial function [PMC2905396]. Real-time TaqMan® MicroRNA Assays were used to confirm the expression of mmu-mir-202 and 18 other microRNAs from high-throughput sequencing data [PMC5569061]. In a study on liver tissues, qRT-PCR was used to validate the expression levels of mmu-mir-202 and other miRNAs [PMC4926493]. The reaction conditions for mmu-mir-202 were 15 min at 95 °C, followed by 40 cycles at 95 °C for 20 s, with an annealing temperature of 55 °C for 20 s and an extension at 72 °C for 30 s [PMC5575838]. Overall, these findings highlight the potential role of mmu-mir-202 in testicular development and its association with mitochondrial function.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCUAUGCAUAUACUUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

Publications