Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla microRNA mir-128 secondary structure diagram

Gorilla gorilla gorilla microRNA mir-128 URS00002D9CBA_9595

  • 82 nucleotides
  • 1 database (Rfam)
  • Found in 39 other species
  • pre_miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Ailuropoda melanoleuca (giant panda) mir-128
  2. Ateles geoffroyi microRNA age-mir-128 precursor
  3. Bos grunniens microRNA 128-1 (ENSBGRG00000001187.1)
  4. Bos taurus microRNA bta-mir-128 precursor (bta-mir-128-1)
  5. Carlito syrichta miRNA (ENSTSYG00000022489.2)
  6. Echinops telfairi (small Madagascar hedgehog) microRNA 128-1 (ENSETEG00000021423.1)
  7. Erinaceus europaeus (western European hedgehog) microRNA 128-1 (ENSEEUG00000016219.1)
  8. Heterocephalus glaber (naked mole-rat) miRNA (ENSHGLG00100022559.2)
  9. Homo sapiens microRNA hsa-mir-128 precursor (hsa-mir-128-1)
  10. Macaca mulatta (Rhesus monkey) microRNA mml-mir-128a precursor
  11. Monodelphis domestica microRNA 128-1 (ENSMODG00000022478.1)
  12. Myotis lucifugus microRNA 128-1 (ENSMLUG00000018063.1)
  13. Notamacropus eugenii microRNA 128-1 (ENSMEUG00000017036.1)
  14. Ochotona princeps microRNA 128-1 (ENSOPRG00000018067.1, ENSOPRG00000019133.1)
  15. Oryctolagus cuniculus microRNA 128-1 (ENSOCUG00000018487.1)
  16. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017312.1)
  17. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-128 precursor
  18. Pan troglodytes (chimpanzee) microRNA ptr-mir-128 precursor (ptr-mir-128-1)
  19. Phascolarctos cinereus microRNA 128-1 (ENSPCIG00000002587.2)
  20. Pongo abelii miRNA
  21. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-128 precursor (ppy-mir-128-1)
  22. Pteropus vampyrus (large flying fox) microRNA 128-1 (ENSPVAG00000024528.1)
  23. Rattus norvegicus microRNA rno-mir-128 precursor (rno-mir-128-1)
  24. Rhinolophus ferrumequinum microRNA 128-1 (ENSRFEG00010006847.1)
  25. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-128 precursor
  26. Sus scrofa microRNA ssc-mir-128 precursor (ssc-mir-128-1)
  27. Tupaia belangeri microRNA 128-1 (ENSTBEG00000017854.1)
  28. Tursiops truncatus microRNA 128-1 (ENSTTRG00000022240.1)
  29. Vicugna pacos (alpaca) microRNA 128-1 (ENSVPAG00000016669.1)
2D structure