v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-128 precursor (bta-mir-128-1) secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-128 precursor (bta-mir-128-1) URS00002D9CBA_9913

Automated summary: This pre miRNA sequence is 82 nucleotides long and is found in Bos taurus. Annotated by 3 databases (miRBase, RefSeq, ENA). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-128, RF00649). Bos taurus (cattle) microRNA bta-mir-128 precursor (bta-mir-128-1) sequence is a product of mir-128-1 precursor, MIR128-1, bta-mir-128-1 precursor, 128-1, mir-128-1, mir-128-1 precurso genes. Found in the Bos taurus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Ailuropoda melanoleuca mir-128
    2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-128 precursor
    3. Bos grunniens (domestic yak) microRNA 128-1 (ENSBGRG00000001187.1)
    4. Callithrix jacchus microRNA mir-128
    5. Camelus ferus microRNA mir-128
    6. Canis lupus familiaris microRNA mir-128
    7. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000022489.2)
    8. Cavia porcellus microRNA mir-128
    9. Chlorocebus sabaeus microRNA mir-128
    10. Dipodomys ordii microRNA mir-128
    11. Echinops telfairi (small Madagascar hedgehog) microRNA 128-1 (ENSETEG00000021423.1)
    12. Equus caballus microRNA mir-128
    13. Erinaceus europaeus microRNA 128-1 (ENSEEUG00000016219.1)
    14. Felis catus microRNA mir-128
    15. Fukomys damarensis microRNA mir-128
    16. Gorilla gorilla gorilla microRNA mir-128
    17. Heterocephalus glaber microRNA mir-128
    18. Homo sapiens microRNA hsa-mir-128 precursor (hsa-mir-128-1)
    19. Macaca mulatta microRNA mml-mir-128a precursor
    20. Monodelphis domestica microRNA 128-1 (ENSMODG00000022478.1)
    21. Myotis brandtii microRNA mir-128
    22. Myotis davidii microRNA mir-128
    23. Myotis lucifugus microRNA 128-1 (ENSMLUG00000018063.1)
    24. Nomascus leucogenys microRNA mir-128
    25. Notamacropus eugenii microRNA 128-1 (ENSMEUG00000017036.1)
    26. Ochotona princeps (American pika) microRNA 128-1 (ENSOPRG00000018067.1, ENSOPRG00000019133.1)
    27. Oryctolagus cuniculus (rabbit) microRNA 128-1 (ENSOCUG00000018487.1)
    28. Otolemur garnettii miRNA MIR128-1 (ENSOGAG00000017312.1)
    29. Ovis aries microRNA mir-128
    30. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-128 precursor
    31. Pan troglodytes microRNA ptr-mir-128 precursor (ptr-mir-128-1)
    32. Papio anubis microRNA mir-128
    33. Phascolarctos cinereus (koala) microRNA 128-1 (ENSPCIG00000002587.2)
    34. Pongo abelii miRNA
    35. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-128 precursor (ppy-mir-128-1)
    36. Pteropus alecto microRNA mir-128
    37. Pteropus vampyrus (large flying fox) microRNA 128-1 (ENSPVAG00000024528.1)
    38. Rattus norvegicus microRNA rno-mir-128 precursor (rno-mir-128-1)
    39. Rhinolophus ferrumequinum microRNA 128-1 (ENSRFEG00010006847.1)
    40. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-128 precursor
    41. Sarcophilus harrisii microRNA mir-128
    42. Sus scrofa microRNA ssc-mir-128 precursor (ssc-mir-128-1)
    43. Tupaia belangeri (northern tree shrew) microRNA 128-1 (ENSTBEG00000017854.1)
    44. Tupaia chinensis microRNA mir-128
    45. Tursiops truncatus (bottlenosed dolphin) microRNA 128-1 (ENSTTRG00000022240.1)
    46. Vicugna pacos (alpaca) microRNA 128-1 (ENSVPAG00000016669.1)
     2D structure Publications