Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-128 precursor (hsa-mir-128-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-128 precursor (hsa-mir-128-1) URS00002D9CBA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR128-1: MIR128-1 is a microRNA gene that interacts with the CDH1 coding protein cadherin through a specific upstream protein called Bmi1, which is the direct target of MIR128-1 [PMC5320387]. MIR128-1 is part of a gene family that includes MIR128-2, and both genes encode different species of microRNAs [PMC5481840]. Specifically, MIR128-1 and MIR128-2 encode miR-128-3p species with identical mature sequences. Additionally, MIR128-1 encodes miR-128-1-5p species, while MIR128-2 encodes miR-128-2-p5 species. These two species differ slightly in their sequences [PMC5481840]. MicroRNAs are small non-coding RNA molecules that play important roles in gene regulation and are involved in various biological processes [PMC5320387]. The interaction between MIR128-1 and CDH1 through Bmi1 suggests a potential regulatory mechanism for cadherin expression mediated by microRNAs [PMC5320387]. The presence of different mature sequences encoded by the MIR128 genes suggests potential functional differences between the miR-p5 and miR-p3p species [PMC5481840]. Overall, these findings highlight the complexity of microRNA regulation and provide insights into the specific interactions between microRNAs and their target proteins. Further research is needed to fully understand the functional significance of these interactions in gene regulation processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Ailuropoda melanoleuca (giant panda) mir-128
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-128 precursor
  3. Bos grunniens (domestic yak) microRNA 128-1 (ENSBGRG00000001187.1)
  4. Bos taurus (cattle) microRNA bta-mir-128 precursor (bta-mir-128-1)
  5. Carlito syrichta (Philippine tarsier) microRNA 128-1 (ENSTSYG00000022489.2)
  6. Echinops telfairi microRNA 128-1 (ENSETEG00000021423.1)
  7. Erinaceus europaeus (western European hedgehog) microRNA 128-1 (ENSEEUG00000016219.1)
  8. Heterocephalus glaber (naked mole-rat) miRNA (ENSHGLG00100022559.2)
  9. Macaca mulatta microRNA mml-mir-128a precursor
  10. Monodelphis domestica (gray short-tailed opossum) microRNA 128-1 (ENSMODG00000022478.1)
  11. Myotis lucifugus (little brown bat) microRNA 128-1 (ENSMLUG00000018063.1)
  12. Notamacropus eugenii microRNA 128-1 (ENSMEUG00000017036.1)
  13. Ochotona princeps microRNA 128-1 (ENSOPRG00000018067.1, ENSOPRG00000019133.1)
  14. Oryctolagus cuniculus microRNA 128-1 (ENSOCUG00000018487.1)
  15. Otolemur garnettii microRNA 128-1 (ENSOGAG00000017312.1)
  16. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-128 precursor
  17. Pan troglodytes (chimpanzee) microRNA ptr-mir-128 precursor (ptr-mir-128-1)
  18. Phascolarctos cinereus (koala) microRNA 128-1 (ENSPCIG00000002587.2)
  19. Pongo abelii miRNA
  20. Pongo pygmaeus microRNA ppy-mir-128 precursor (ppy-mir-128-1)
  21. Pteropus vampyrus microRNA 128-1 (ENSPVAG00000024528.1)
  22. Rattus norvegicus microRNA rno-mir-128 precursor (rno-mir-128-1)
  23. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 128-1 (ENSRFEG00010006847.1)
  24. Saguinus labiatus microRNA sla-mir-128 precursor
  25. Sus scrofa microRNA ssc-mir-128 precursor (ssc-mir-128-1)
  26. Tupaia belangeri microRNA 128-1 (ENSTBEG00000017854.1)
  27. Tursiops truncatus microRNA 128-1 (ENSTTRG00000022240.1)
  28. Vicugna pacos (alpaca) microRNA 128-1 (ENSVPAG00000016669.1)
2D structure Publications