v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cyprinus carpio (common carp) ccr-miR-7b URS00002D98BC_7962

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAGACUUGUGAUUUUGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Brugia malayi (agent of lymphatic filariasis) bma-miR-7
  2. Brugia pahangi microRNA bpa-mir-7
  3. Chrysemys picta bellii Cpi-Mir-7-P3_5p (mature (guide))
  4. Chrysemys picta cpi-miR-7b-5p
  5. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-175650
  6. Gallus gallus Gallus_gallus piRNA piR-gga-241204
  7. Ictalurus punctatus (channel catfish) ipu-miR-7b
  8. Mus musculus mmu-miR-7b-5p
  9. Rattus norvegicus rno-miR-7b