Brugia malayi (agent of lymphatic filariasis) bma-miR-7 URS00002D98BC_6279

• 23 nucleotides
• 2 databases (ENA, miRBase)
• Found in 9 other species
• 1 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGGAAGACUUGUGAUUUUGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

1. Brugia pahangi microRNA bpa-mir-7
2. Chrysemys picta bellii Cpi-Mir-7-P3_5p (mature (guide))
3. Chrysemys picta cpi-miR-7b-5p
4. Cyprinus carpio ccr-miR-7b
5. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-175650
6. Gallus gallus Gallus_gallus piRNA piR-gga-241204
7. Ictalurus punctatus (channel catfish) ipu-miR-7b
8. Mus musculus mmu-miR-7b-5p
9. Rattus norvegicus rno-miR-7b

Publications Download

• FASTA
• JSON