Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-7b URS00002D98BC_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-7b: Rno-mir-7b is a microRNA that was not detected in a study [PMC2864251]. In another study, rno-mir-7b was identified as one of the five candidate miRNAs, along with rno-miR-219a-5p, rno-miR-486, rno-miR-136-5p, and rno-miR-128-3p, that were assembled in an integrated miRNA-mRNA pathway network [PMC7339738]. However, there was no significant difference in the expression of rno-mir-7b between different groups [PMC7339738]. To validate the results obtained from next-generation sequencing (NGS), five miRNAs including rno-mir-7b were selected as candidate miRNAs and screened due to their involvement in spinal cord injury (SCI) recovery [PMC7339738]. In another study examining different time points, rno-mir-7b did not fall into the statistically significant category [PMC3688919]. Furthermore, in a network analysis of ferroptosis-related differentially expressed genes (DEGs), rno-mir-7b was identified as one of the 31 microRNAs that were cross-linked with multiple DEGs [PMC9727440]. References: [PMC2864251]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2864251/ [PMC7339738]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7339738/ [PMC3688919]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3688919/ [PMC9727440]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9727440/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAGACUUGUGAUUUUGUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Brugia malayi (agent of lymphatic filariasis) bma-miR-7
  2. Brugia pahangi microRNA bpa-mir-7
  3. Chrysemys picta bellii Cpi-Mir-7-P3_5p (mature (guide))
  4. Chrysemys picta cpi-miR-7b-5p
  5. Cyprinus carpio ccr-miR-7b
  6. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-175650
  7. Gallus gallus Gallus_gallus piRNA piR-gga-241204
  8. Ictalurus punctatus (channel catfish) ipu-miR-7b
  9. Mus musculus mmu-miR-7b-5p
Publications