Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-7b-5p URS00002D98BC_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 5 databases (IntAct, PirBase, TarBase, ENA, LncBase). Described in 7 papers. Mus musculus (house mouse) mmu-miR-7b-5p sequence is a product of mmu-miR-7b-5p, mmu-miR-7b, miR-7b-5p, miR-7, miR-7b genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610033N24Rik, 1620401A02Rik, 2210017D18Rik, 2210017P03Rik, 2310040B03Rik, 2410018J24Rik, 2600010P09Rik, 3200001K10Rik, 4833414I07Rik, 4833422F24Rik.

Interactions 2

According to IntAct, Mus musculus (house mouse) mmu-miR-7b-5p interacts with:

IntAct ID Participant Synonyms
EBI-20561405 intact:EBI-20560979 EBI-20560979 ENSMUST00000051477.12 mrna_cdc42
EBI-20566801 intact:EBI-20566812 EBI-20566812 mmu-mir-7 5p inhibitor

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGAAGACUUGUGAUUUUGUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 7 other species

    1. Brugia malayi bma-miR-7
    2. Brugia pahangi microRNA bpa-mir-7
    3. Chrysemys picta (Painted turtle) cpi-miR-7b-5p
    4. Cyprinus carpio (common carp) ccr-miR-7b
    5. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-175650
    6. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-241204
    7. Ictalurus punctatus (channel catfish) ipu-miR-7b
    8. Rattus norvegicus rno-miR-7b