Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-429a URS00002D8367_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (MirGeneDB, ENA, miRBase, RefSeq). Described in 20 papers. Danio rerio (zebrafish) dre-miR-429a sequence is a product of miR-429a, dre-miR-429a, miR-429, mir429 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAUACUGUCUGGUAAUGCCGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 218 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-8-P3a_3p (mature (guide))
    2. Anolis carolinensis aca-miR-429-3p
    3. Bos taurus bta-miR-429
    4. Callorhinchus milii (elephant shark) Cmi-Mir-8-P3a_3p (mature (guide))
    5. Canis lupus familiaris cfa-miR-429
    6. Cavia porcellus cpo-miR-429-3p
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-8-P3a_3p (mature (guide))
    8. Chrysemys picta cpi-miR-429-3p
    9. Columba livia (rock pigeon) cli-miR-429-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-429
    11. Cyprinus carpio (common carp) ccr-miR-429
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-429-3p
    13. Gadus morhua (Atlantic cod) gmo-miR-429-3p
    14. Gallus gallus gga-miR-429-3p
    15. Gekko japonicus Gja-Mir-8-P3a_3p (mature (guide))
    16. Haplochromis burtoni abu-miR-429b
    17. Latimeria chalumnae (coelacanth) Lch-Mir-8-P3a_3p (mature (guide))
    18. Lepisosteus oculatus Loc-Mir-8-P3a_3p (mature (guide))
    19. Maylandia zebra (zebra mbuna) mze-miR-429b
    20. Microcaecilia unicolor Mun-Mir-8-P3a_3p (mature (guide))
    21. Monopterus albus Mal-Mir-8-P3a_3p (mature (guide))
    22. Mus musculus (house mouse) mmu-miR-429-3p
    23. Neolamprologus brichardi nbr-miR-429b
    24. Oreochromis niloticus oni-miR-429b
    25. Ornithorhynchus anatinus oan-miR-429-3p
    26. Pteropus alecto pal-miR-429-3p
    27. Pundamilia nyererei pny-miR-429b
    28. Python bivittatus (Burmese python) pbv-miR-429-3p
    29. Rattus norvegicus (Norway rat) rno-miR-429
    30. Scyliorhinus torazame Sto-Mir-8-P3a_3p (mature (guide))
    31. Sphenodon punctatus (tuatara) Spt-Mir-8-P3a_3p (mature (guide))
    32. Sus scrofa ssc-miR-429
    33. Takifugu rubripes (torafugu) fru-miR-429
    34. Tetraodon nigroviridis tni-miR-429
    35. Tor tambroides miR-429a
    36. Xenopus laevis (African clawed frog) xla-miR-429-3p
    37. Xenopus tropicalis (tropical clawed frog) xtr-miR-429
    Publications New