Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-429 URS00002D8367_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-429: Rno-mir-429 is a specific mature miRNA that has been identified in various studies. It has been found to be differentially expressed in MCAO rat blood samples compared to sham-operated rat blood samples, along with other miRNAs such as rno-mir-191b, rno-mir-743a, rno-miR-128-2-5p, rno-miR-383-5p, rno-miR-3552, rno-miR-107-5p, rno-miR-137-3p, rno-mir-194-1 [PMC7381948]. Rno-mir429 has also been shown to be closely related to the biological processes of arrhythmias [PMC7425585]. It is associated with the target gene KCNQ4 and is involved in the delayed rectifier potassium channel and potassium ion transport across cell membranes [PMC7425585]. Additionally, Rno-mir429 has been found to target heat shock protein family A (Hsp70) member 9 (Hspa9) and members of the DNAJ heat shock protein family (Hsp40) [PMC6377737]. In F344 rat livers treated with Aflatoxin B1, there was an increase in RnOmiR34a05p and RnOmiR200b03p as well as a decrease in miRNA130a03p [PMC4873990]. In CCI rat spinal cords, RnOmiR200b and RnOmir429 were downregulated and were found to target Zeb1 mRNA expression [PMC8914318].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGUCUGGUAAUGCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Alligator mississippiensis Ami-Mir-8-P3a_3p (mature (guide))
  2. Anolis carolinensis aca-miR-429-3p
  3. Bos taurus bta-miR-429
  4. Callorhinchus milii Cmi-Mir-8-P3a_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-429
  6. Cavia porcellus cpo-miR-429-3p
  7. Chrysemys picta bellii Cpi-Mir-8-P3a_3p (mature (guide))
  8. Chrysemys picta cpi-miR-429-3p
  9. Columba livia cli-miR-429-3p
  10. Cricetulus griseus cgr-miR-429
  11. Cyprinus carpio ccr-miR-429
  12. Danio rerio dre-miR-429a
  13. Dasypus novemcinctus dno-miR-429-3p
  14. Gadus morhua gmo-miR-429-3p
  15. Gallus gallus gga-miR-429-3p
  16. Gekko japonicus Gja-Mir-8-P3a_3p (mature (guide))
  17. Haplochromis burtoni abu-miR-429b
  18. Latimeria chalumnae (coelacanth) Lch-Mir-8-P3a_3p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-8-P3a_3p (mature (guide))
  20. Maylandia zebra mze-miR-429b
  21. Microcaecilia unicolor Mun-Mir-8-P3a_3p (mature (guide))
  22. Monopterus albus (swamp eel) Mal-Mir-8-P3a_3p (mature (guide))
  23. Mus musculus mmu-miR-429-3p
  24. Neolamprologus brichardi (lyretail cichlid) nbr-miR-429b
  25. Oreochromis niloticus oni-miR-429b
  26. Ornithorhynchus anatinus (platypus) oan-miR-429-3p
  27. Pteropus alecto pal-miR-429-3p
  28. Pundamilia nyererei pny-miR-429b
  29. Python bivittatus pbv-miR-429-3p
  30. Scyliorhinus torazame (cloudy catshark) Sto-Mir-8-P3a_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-8-P3a_3p (mature (guide))
  32. Sus scrofa ssc-miR-429
  33. Takifugu rubripes fru-miR-429
  34. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-429
  35. Tor tambroides miR-429a
  36. Xenopus laevis xla-miR-429-3p
  37. Xenopus tropicalis (tropical clawed frog) xtr-miR-429
Publications