Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-222-3p URS00002D6573_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-222: Mmu-mir-222 is a microRNA that has been found to be involved in lymphoid development and is differentially expressed between distinguishable lymphocyte cell types [PMC2244641]. It is also highly enriched during adipogenesis [PMC3319598]. Mmu-mir-222 has been identified as a potential target for Hif-1α and TNF-α, which are involved in cell differentiation regulation [PMC3319598]. It has also been predicted to have complementary binding sites with the 3´UTR of Rad51c mRNA [PMC6953820]. Mmu-mir-222, along with other miRNAs, has been found to be up-regulated in white adipose tissue (WAT) after high-fat diet (HFD) feeding [PMC3319598]. In a model of mouse leukemia, mmu-mir-222 is differentially expressed across disease and normal conditions [PMC3919606]. Mmu-mir-222 has experimentally validated targets and is correlated with validated target genes in the IPA database [PMC6209654]. It is also one of the miRNAs that are overexpressed in dendritic cells after CpG stimulation [PMC6963666]. Mmu-mir-222 can regulate the expression of PCNA and may have potential implications for cancer research [PMC3861310]. In network analysis, mmu-mir-221 & mmu-mir-222 were found to have a high number of common target proteins [PMC6833270]. Additionally, mmu-mir-222 was identified as one of the potential miRNAs involved in C2C12 muscle cell differentiation, being downregulated during this process [PMC3753644].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Publications