Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3155a URS00002D349B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3155a: Hsa-mir-3155a is a microRNA that has been studied in various contexts. In a study, the predicted 3D structures of premature and mature hsa-mir-3155a were shown, along with other miRNAs [PMC9023806]. The conservation pattern of the target site in different strains highlights the importance of hsa-mir-3155a [PMC9023806]. The genomic position of hsa-mir-3155a was identified as Chr10: 6152196-6152277 [PMC9023806]. Docking results revealed the binding pattern of hsa-mir-3155a to the mRNA of HEF protein, suggesting its involvement in transcriptional activity [PMC9023806]. Hsa-mir-3155a, along with other miRNAs, has been found to bind to the influenza virus genome [PMC9023806]. Prediction results showed that hsa-mir-3155a has good binding complementarity to influenza genome [PMC9023806]. In intersection graph analysis, it was found that hsa-mir-3155a is common in three algorithm methods, indicating its potential binding with targeted sites in influenza C virus genome [PMC9023806]. Hsa-mir-3155a has also been studied in relation to other miRNAs. It was identified as one of the top predicted target miRNAs for hsa-circRNA_005019 along with other miRNAs [PMC5544722]. Hsa-mir-3155a has been found to be expressed in various tissues including the brain at variable levels [PMC8699332]. In patients with major depressive disorder, expression of hsa-mir-3155a was significantly upregulated in a specific brain region called anterior cingulate cortex [PMC8699332]. Overall, these studies provide insights into the structure, conservation, binding potential, and expression patterns of hsa-mir-3155a in different contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGGCUCUGCAGUGGGAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications