Automated summary: This pre miRNA sequence is 125 nucleotides long and is found in Arabidopsis thaliana. Annotated by 5 databases (ENA, miRBase, RefSeq, Rfam, Ensembl Plants). Matches 1 Rfam family (mir-172, RF00452). Arabidopsis thaliana miR172e stem-loop (ath-MIR172e) sequence is a product of 172 microRNA precursor famil, MIR172e precursor, MIR172e precurso, 172 microRNA precursor family, MIR172e, mir-172 microRNA precursor family, ath-MIR172e precursor, AT5G59505 genes. Found in the Arabidopsis thaliana reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GUAGUCGCAGAUGCAGCACCAUUAAGAUUCACAAGAGAUGUGGUUCCCUUUGCUUUCGCCUCUCGAUCCGCAGAAAAGGGUUCCUUAUCGAGUGGGAAUCUUGAUGAUGCUGCAUCAGCAAAUAC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.