v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus domesticus (western European house mouse) transfer RNA-Thr secondary structure diagram

Mus musculus domesticus (western European house mouse) transfer RNA-Thr URS00002D0E0C_10092

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCUUGAUAGUAUAAACAUUACUCUGGUCUUGUAAACCUGAAAUGAAGAUCUUCUCUUCUCAAGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Mus musculus helgolandicus tRNA-Thr
  2. Mus musculus (mouse) mitochondrially encoded tRNA threonine (ENSMUSG00000064371.1)
  3. Mus musculus musculus tRNA-Thr
 2D structure