Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus domesticus (western European house mouse) transfer RNA-Thr secondary structure diagram

Mus musculus domesticus (western European house mouse) transfer RNA-Thr URS00002D0E0C_10092

Automated summary: This tRNA sequence is 67 nucleotides long and is found in Mus musculus domesticus. Annotated by 1 database (ENA). Described in 8 papers. Has a conserved secondary structure or a structured region. Mus musculus domesticus (western European house mouse) transfer RNA-Thr sequence is a product of trnT, tRNA-Thr genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCUUGAUAGUAUAAACAUUACUCUGGUCUUGUAAACCUGAAAUGAAGAUCUUCUCUUCUCAAGACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Mus musculus helgolandicus tRNA-Thr
    2. Mus musculus mitochondrially encoded tRNA threonine
    3. Mus musculus musculus tRNA-Thr
    2D structure New