Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia hominivorax (primary screw-worm) mature cho-miR-100-5p URS00002CFB5F_115425

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Cochliomyia hominivorax. Annotated by 1 database (ENA). Described in 1 paper.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACCCGUAAAUCCGAACUUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Bactrocera dorsalis (oriental fruit fly) bdo-miR-100
    2. Dasypus novemcinctus (nine-banded armadillo) Dan-Mir-10-P2_5p (mature (guide))
    3. Drosophila ananassae dan-miR-100
    4. Drosophila erecta der-miR-100
    5. Drosophila grimshawi dgr-miR-100
    6. Drosophila melanogaster dme-miR-100-5p
    7. Drosophila mojavensis dmo-miR-100
    8. Drosophila sechellia dse-miR-100
    9. Drosophila simulans dsi-miR-100
    10. Drosophila willistoni dwi-miR-100
    11. Drosophila yakuba dya-miR-100