Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4469 URS00002CEB74_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4469: Hsa-mir-4469 is a candidate reference miRNA that has been studied in various contexts. In a study on exosomes of ovarian cancer patients, hsa-mir-4469 was found to have the highest expression level among the miRNAs analyzed [PMC7789813]. Additionally, hsa-mir-4469 has been identified as a potential tumor suppressor in colorectal cancer, as it regulates the infiltration of inflammatory cells [PMC10050890]. Furthermore, hsa-mir-4469 has been found to have continuously decreasing expression in colorectal cancer progression [PMC9304430]. In terms of target genes, hsa-mir-4469 was found to have a higher number of target genes among the decreasing miRNAs in colorectal cancer [PMC9304430]. Overall, these findings suggest that hsa-mir-4469 may play important roles in ovarian cancer and colorectal cancer progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCCCUCUAGGGUCGCUCGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications