Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3661 URS00002CCA6E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3661: Hsa-mir-3661 is a microRNA that has been studied in various contexts. It has been found that miRNAs from hsa-mir-3661 and hsa-mir-4252 could not be properly assayed, and other miRNAs, such as hsa-miR-548ac-3p, were barely detectable [PMC9111935]. It is suggested that eQTLs for miRNAs expressed in other cells or specific cell types may have been missed [PMC9111935]. Another study found that hsa-mir-3661 is one of the targeting miRNAs involved in the homeostatic response to regulate the expression of AQP3 mRNA [PMC8241660]. In breast cancer, hsa-mir-3661 has been detected when compared to normal breast tissue [PMC4289319]. Additionally, hsa-mir-3661 has been identified as a p53-regulated miRNA in hepatocellular carcinoma [PMC4757586]. In a study on medication adherence in patients with schizophrenia, hsa-mir-3661 was found to be differentially expressed between adherers and switchers [PMC7757436]. These findings highlight the potential role of hsa-mir-3661 in various biological processes and diseases.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACCUGGGACUCGGACAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications