Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-34c-5p URS00002C7B2B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-34c: Hsa-mir-34c is a member of the hsa-miR-34 family, which consists of hsa-miR-34a, hsa-miR-34b, and hsa-miR-34c. These members have highly homologous sequences and share similar target genes and functions [22]. The hsa-miR-34a gene is located at chromosome 1p36, while hsa-miR-34b and c are cotranscribed as part of the same gene cluster located at 11q23 [23]. Studies have shown that hsa-mir-34c is downregulated in various tumors, including breast cancer and prostate cancer, where it functions as a tumor suppressor gene [24][25]. In non-small cell lung cancer (NSCLC), miR-34c is expressed at low levels. However, overexpression of miR-34c in NSCLC cells can inhibit proliferation, induce apoptosis, and inhibit invasion or metastasis [26]. The clinical significance of miR-34c expression in NSCLC-derived exosomes has not been extensively studied. Additionally, the molecular mechanism underlying the development of NSCLC has not been fully elucidated [27]. In a study on chronic pancreatitis (CP), three upregulated differentially expressed microRNAs (DEmiRs) were identified: hsa-miR-206, hsa-mir-34c, and hsa-miR-484. These DEmiRs were found to potentially target NOTCH3 [28].

mRNA interactions 12 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGUGUAGUUAGCUGAUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis Ami-Mir-34-P2b_5p (mature (guide))
  2. Bos taurus (cattle) Bta-Mir-34-P2b_5p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-34c
  4. Canis lupus familiaris (dog) cfa-miR-34c
  5. Capra hircus (goat) chi-miR-34c-5p
  6. Cavia porcellus cpo-miR-34c-5p
  7. Chrysemys picta bellii Cpi-Mir-34-P2b_5p (mature (guide))
  8. Chrysemys picta cpi-miR-34c-5p
  9. Columba livia (rock pigeon) cli-miR-34c-5p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-34c-5p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34c-5p
  12. Echinops telfairi Ete-Mir-34-P2b_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-34c
  14. Gallus gallus gga-miR-34c-5p
  15. Macaca mulatta mml-miR-34c-5p
  16. Microcebus murinus mmr-miR-34c
  17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-34c-5p
  18. Mus musculus (house mouse) mmu-miR-34c-5p
  19. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-34c
  20. Ornithorhynchus anatinus oan-miR-34a-5p
  21. Oryctolagus cuniculus (rabbit) ocu-miR-34c-5p
  22. Otolemur garnettii (small-eared galago) oga-miR-34c
  23. Pan paniscus ppa-miR-34c
  24. Pongo pygmaeus ppy-miR-34c-5p
  25. Pteropus alecto pal-miR-34c-5p
  26. Rattus norvegicus (Norway rat) rno-miR-34c-5p
  27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P2b_5p (mature (guide))
  28. Scyliorhinus torazame Sto-Mir-34-P2a_5p (mature (guide))
  29. Sphenodon punctatus Spt-Mir-34-P2b_5p (mature (guide))
  30. Sus scrofa (pig) ssc-miR-34c
  31. Taeniopygia guttata tgu-miR-34b
  32. Tupaia chinensis tch-miR-34c-5p
  33. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1334552
Publications