Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-34c-5p URS00002C7B2B_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (GeneCards, LncBase, RefSeq, IntAct, TarBase, ENA, miRBase, MirGeneDB, MalaCards). Homo sapiens (human) hsa-miR-34c-5p sequence is a product of miR-34c, hsa-miR-34c, hsa-miR-34c-5p, MIR34C, miR-34c-5p, miR-34 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16E1BP, 4.1B, A2D, A2lp, AADACL1, AAVR, ABCA5, ABP1, ACAD7, ACADSB.

Interactions 13

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-34c-5p interacts with:

Interaction id Participant Synonyms
EBI-11709655 intact:EBI-11709120 EBI-11709120 lnc_arsr
EBI-11785294 intact:EBI-11709120 EBI-11709120 lnc_arsr
EBI-26593715 intact:EBI-26567461 EBI-26567461 ENST00000307102 mrna_mek1
EBI-26593704 intact:EBI-26593833 EBI-26593833 ENST00000672401 mrna_acsl4
EBI-26593720 intact:EBI-26594258 EBI-26594258 ENST00000308191 mrna_pde7b
EBI-26593725 intact:EBI-26594761 EBI-26594761 ENST00000257290 mrna_pdgfra
EBI-26593730 intact:EBI-26594777 EBI-26594777 ENST00000373241 mrna_sar1a
URS00002C7B2B_9606-5 P10636 P10636
URS00002C7B2B_9606-0 P10636 P10636
URS00002C7B2B_9606-1 P18206 P18206
URS00002C7B2B_9606-2 P41182 P41182
URS00002C7B2B_9606-3 Q9H488 Q9H488
URS00002C7B2B_9606-4 Q9NPR2 Q9NPR2

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGGCAGUGUAGUUAGCUGAUUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-34-P2b_5p (mature (guide))
    2. Bos taurus (cattle) Bta-Mir-34-P2b_5p (mature (guide))
    3. Callithrix jacchus cja-miR-34c
    4. Canis lupus familiaris (dog) cfa-miR-34c
    5. Capra hircus (goat) chi-miR-34c-5p
    6. Cavia porcellus cpo-miR-34c-5p
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-34-P2b_5p (mature (guide))
    8. Chrysemys picta cpi-miR-34c-5p
    9. Columba livia (rock pigeon) cli-miR-34c-5p
    10. Cricetulus griseus cgr-miR-34c-5p
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34c-5p
    12. Echinops telfairi Ete-Mir-34-P2b_5p (mature (guide))
    13. Equus caballus eca-miR-34c
    14. Gallus gallus (chicken) gga-miR-34c-5p
    15. Macaca mulatta mml-miR-34c-5p
    16. Microcebus murinus (gray mouse lemur) mmr-miR-34c
    17. Monodelphis domestica mdo-miR-34c-5p
    18. Mus musculus mmu-miR-34c-5p
    19. Nomascus leucogenys nle-miR-34c
    20. Ornithorhynchus anatinus (platypus) oan-miR-34a-5p
    21. Oryctolagus cuniculus ocu-miR-34c-5p
    22. Otolemur garnettii (small-eared galago) oga-miR-34c
    23. Pan paniscus (pygmy chimpanzee) ppa-miR-34c
    24. Pongo pygmaeus (Bornean orangutan) ppy-miR-34c-5p
    25. Pteropus alecto (black flying fox) pal-miR-34c-5p
    26. Rattus norvegicus rno-miR-34c-5p
    27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P2b_5p (mature (guide))
    28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-34-P2a_5p (mature (guide))
    29. Sphenodon punctatus (tuatara) Spt-Mir-34-P2b_5p (mature (guide))
    30. Sus scrofa ssc-miR-34c
    31. Taeniopygia guttata (zebra finch) tgu-miR-34b
    32. Tupaia chinensis (Chinese tree shrew) tch-miR-34c-5p
    33. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1334552
    Publications New