Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-34c-5p URS00002C7B2B_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (MirGeneDB, LncBase, RefSeq, ENA, TarBase, miRBase, PirBase). Described in 38 papers. Mus musculus (house mouse) mmu-miR-34c-5p sequence is a product of Mir34c, miR-34, miR-34c, miR-34c-5p, mmu-miR-34c-5p, mmu-miR-34c genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007H07Rik, 0610010H08Rik, 0610010I13Rik, 0610012C09Rik, 0610013I17Rik, 0610025L06Rik, 0610038M01Rik, 0610039H12Rik, 0710001O03Rik, 0710008J23Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGCAGUGUAGUUAGCUGAUUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-34-P2b_5p (mature (guide))
    2. Bos taurus Bta-Mir-34-P2b_5p (mature (guide))
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-34c
    4. Canis lupus familiaris cfa-miR-34c
    5. Capra hircus chi-miR-34c-5p
    6. Cavia porcellus (domestic guinea pig) cpo-miR-34c-5p
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-34-P2b_5p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-34c-5p
    9. Columba livia cli-miR-34c-5p
    10. Cricetulus griseus cgr-miR-34c-5p
    11. Dasypus novemcinctus dno-miR-34c-5p
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-34-P2b_5p (mature (guide))
    13. Equus caballus (horse) eca-miR-34c
    14. Gallus gallus (chicken) gga-miR-34c-5p
    15. Homo sapiens (human) hsa-miR-34c-5p
    16. Macaca mulatta mml-miR-34c-5p
    17. Microcebus murinus mmr-miR-34c
    18. Monodelphis domestica (gray short-tailed opossum) mdo-miR-34c-5p
    19. Nomascus leucogenys nle-miR-34c
    20. Ornithorhynchus anatinus (platypus) oan-miR-34a-5p
    21. Oryctolagus cuniculus (rabbit) ocu-miR-34c-5p
    22. Otolemur garnettii oga-miR-34c
    23. Pan paniscus ppa-miR-34c
    24. Pongo pygmaeus ppy-miR-34c-5p
    25. Pteropus alecto pal-miR-34c-5p
    26. Rattus norvegicus rno-miR-34c-5p
    27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P2b_5p (mature (guide))
    28. Scyliorhinus torazame Sto-Mir-34-P2a_5p (mature (guide))
    29. Sus scrofa (pig) ssc-miR-34c
    30. Taeniopygia guttata (zebra finch) tgu-miR-34b
    31. Tupaia chinensis (Chinese tree shrew) tch-miR-34c-5p
    32. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1334552