Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-222 URS00002C6949_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-222: Bta-mir-222 is a differentially expressed (DE) miRNA that has been identified in various studies. It has been found to be shared between different groups in a Venn diagram analysis [PMC10000098]. Bta-mir-222 has also been detected with different abundance levels in cows at embryo transfer [PMC5662615]. In addition, it has been shown to suppress certain genes as targets, such as PSTPIP2, VAV1, and SOCS3 [PMC8928958]. Bta-mir-222 is among the DE miRNAs that have functions related to mastitis [PMC8928958]. It has also been found to be upregulated in extracellular vesicles (EVs) from competent embryos and downregulated in EVs from arrested embryos [PMC7727673]. Furthermore, bta-mir-222 has been identified as one of the DE miRNAs associated with SF groups and its expression was found to be upregulated in mastitis-affected cows [PMC4156418] [PMC6008395]. Bta-mir-222 is also involved in lipid metabolism and its downregulation affects lipid metabolism-related differential miRNAs [PMC8850724]. It has been detected at low levels or not detected at all in the ovarian cortex, while its expression was exclusively found in cumulus cells [PMC2762473]. Moreover, bta-mir-222 plays a role in viral infection by targeting interferon regulatory factor 2 (IRF2) and affecting interferon-I expression and CPIV3 replication [PMC9228844]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Canis lupus familiaris (dog) cfa-miR-222
  2. Equus caballus (horse) eca-miR-222
  3. Homo sapiens (human) hsa-miR-222-3p
  4. Macaca mulatta mml-miR-222-3p
  5. Mus musculus (house mouse) TARBASE:mmu-miR-222-3p
  6. Ornithorhynchus anatinus oan-miR-222a-3p
  7. Pongo pygmaeus ppy-miR-222
  8. Rattus norvegicus (Norway rat) rno-miR-222-3p
  9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
  10. Tupaia chinensis tch-miR-222-3p
  11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3161177
Publications