Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-222 URS00002C6949_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-222: Cfa-mir-222 is a miRNA that has been identified as a breast cancer-related miRNA in several studies [PMC9917093]. In a study comparing BCMT-T and BCMT-N, cfa-mir-222 was found to be differentially expressed [PMC9917093]. Similarly, in another study comparing MCMT-T and MCMT-N, cfa-mir-222 was also identified as a breast cancer-related miRNA [PMC9917093]. This study was the first to record the significant upregulation of cfa-mir-222 in MCMT [PMC9917093]. However, there have been limited studies conducted on cfa-mir-222 compared to humans [PMC9917093]. To validate the expression levels of miRNAs obtained through high-sequencing, including cfa-mir-222, qPCR was performed on four randomly selected differentially expressed miRNAs [PMC4768678]. In this validation study, cfa-miR-124 was found to be significantly upregulated while there was no significant change observed for cfa-mir-222 in CFDP1_ vs_CFDP2 [PMC4768678]. In summary, cfa-mir-222 is a breast cancer-related miRNA that has been identified as differentially expressed in studies comparing BCMT-T and BCMT-N as well as MCMT-T and MCMT-N. However, there have been limited studies conducted on this particular miRNA compared to humans. Additionally, qPCR validation showed significant upregulation of another miRNA (cfa-miR-124) but no significant change for cfa-mir-222.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (cattle) bta-miR-222
  2. Equus caballus (horse) eca-miR-222
  3. Homo sapiens (human) hsa-miR-222-3p
  4. Macaca mulatta mml-miR-222-3p
  5. Mus musculus (house mouse) TARBASE:mmu-miR-222-3p
  6. Ornithorhynchus anatinus oan-miR-222a-3p
  7. Pongo pygmaeus ppy-miR-222
  8. Rattus norvegicus (Norway rat) rno-miR-222-3p
  9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
  10. Tupaia chinensis tch-miR-222-3p
  11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3161177
Publications