Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-222 URS00002C6949_9600

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Pongo pygmaeus. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUACAUCUGGCUACUGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Bos taurus bta-miR-222
    2. Canis lupus familiaris cfa-miR-222
    3. Equus caballus eca-miR-222
    4. Homo sapiens hsa-miR-222-3p
    5. Macaca mulatta mml-miR-222-3p
    6. Mus musculus (house mouse) TARBASE:mmu-miR-222-3p
    7. Ornithorhynchus anatinus (platypus) oan-miR-222a-3p
    8. Rattus norvegicus rno-miR-222-3p
    9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
    10. Tupaia chinensis tch-miR-222-3p
    11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3161177