Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-222-3p URS00002C6949_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-222: Rno-mir-222 is a highly abundant miRNA in DHT-treated ovaries [PMC3682887]. It is also exclusively expressed in the theca of cystic follicles [PMC3682887]. Rno-mir-222 has been associated with cardiac hypertrophy [PMC5856749]. It has been found to target Acadm and Echs2 genes [PMC6377737]. MiR-222 knockout rats have been generated using CRISPR technology to study the effects of rno-mir-222 deletion [PMC8626841]. Rno-mir-222, along with rno-miR-221, rno-miR-25, and rno-miR-26b, has been found to be differentially expressed in rats with polycystic ovary syndrome (PCOS) compared to control rats [PMC4838149]. In summary, rno-mir-222 is a highly abundant miRNA in DHT-treated ovaries and is exclusively expressed in the theca of cystic follicles. It has been associated with cardiac hypertrophy and has been found to target Acadm and Echs2 genes. MiR-222 knockout rats have been generated using CRISPR technology. Additionally, rno-mir-222, along with other miRNAs such as rno-miR-221, rno-miR25, and rno-miR26b, is differentially expressed in rats with PCOS compared to control rats.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (cattle) bta-miR-222
  2. Canis lupus familiaris (dog) cfa-miR-222
  3. Equus caballus (horse) eca-miR-222
  4. Homo sapiens (human) hsa-miR-222-3p
  5. Macaca mulatta mml-miR-222-3p
  6. Mus musculus (house mouse) TARBASE:mmu-miR-222-3p
  7. Ornithorhynchus anatinus oan-miR-222a-3p
  8. Pongo pygmaeus ppy-miR-222
  9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
  10. Tupaia chinensis tch-miR-222-3p
  11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3161177
Publications