Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-222-3p URS00002C6949_10116

Automated summary: This piRNA sequence is 21 nucleotides long and is found in Rattus norvegicus. Annotated by 4 databases (RefSeq, PirBase, PSICQUIC, miRBase). Rattus norvegicus (Norway rat) rno-miR-222-3p sequence is a product of miR-222-3p, rno-miR-222, Mir222, miR-222, rno-miR-222-3p genes. Found in the norway rat reference genome.

Interactions 6

According to PSICQUIC, Rattus norvegicus (Norway rat) rno-miR-222-3p interacts with:

Interaction id Participant Synonyms
URS00002C6949_10116-0 O08769 O08769
URS00002C6949_10116-3 O08769 O08769
URS00002C6949_10116-1 Q3T1K1 Q3T1K1
URS00002C6949_10116-4 Q3T1K1 Q3T1K1
URS00002C6949_10116-2 Q69DC1 Q69DC1
URS00002C6949_10116-5 Q69DC1 Q69DC1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUACAUCUGGCUACUGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Bos taurus bta-miR-222
    2. Canis lupus familiaris cfa-miR-222
    3. Equus caballus (horse) eca-miR-222
    4. Homo sapiens (human) hsa-miR-222-3p
    5. Macaca mulatta (Rhesus monkey) mml-miR-222-3p
    6. Mus musculus (house mouse) TARBASE:mmu-miR-222-3p
    7. Ornithorhynchus anatinus oan-miR-222a-3p
    8. Pongo pygmaeus ppy-miR-222
    9. Sarcophilus harrisii sha-miR-222
    10. Tupaia chinensis (Chinese tree shrew) tch-miR-222-3p
    11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3161177
    Publications New