Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) TARBASE:mmu-miR-222-3p URS00002C6949_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 4 databases (ENA, PirBase, LncBase, TarBase). Mus musculus (house mouse) TARBASE:mmu-miR-222-3p sequence is a product of mmu-miR-222, miR-222, mmu-miR-222-3p, miR-222-3p genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610009M14Rik, 0610010K06Rik, 0610043B10Rik, 0710001G09Rik, 0710005M05Rik, 0910001K20Rik, 100kDa, 1100001I19Rik, 1110001M19Rik, 1110001P04Rik.

Interactions 16

According to PSICQUIC, Mus musculus (house mouse) TARBASE:mmu-miR-222-3p interacts with:

Interaction id Participant Synonyms
URS00002C6949_10090-0 O54918 O54918
URS00002C6949_10090-8 O54918 O54918
URS00002C6949_10090-9 P15037 P15037
URS00002C6949_10090-1 P15037 P15037
URS00002C6949_10090-2 P23906 P23906
URS00002C6949_10090-10 P23906 P23906
URS00002C6949_10090-4 P27577 P27577
URS00002C6949_10090-3 P27577 P27577
URS00002C6949_10090-12 P27577 P27577
URS00002C6949_10090-11 P27577 P27577
URS00002C6949_10090-13 P40224 P40224
URS00002C6949_10090-5 P40224 P40224
URS00002C6949_10090-6 Q66JW3 Q66JW3
URS00002C6949_10090-14 Q66JW3 Q66JW3
URS00002C6949_10090-15 Q91ZE9 Q91ZE9
URS00002C6949_10090-7 Q91ZE9 Q91ZE9

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUACAUCUGGCUACUGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Bos taurus (cattle) bta-miR-222
    2. Canis lupus familiaris (dog) cfa-miR-222
    3. Equus caballus eca-miR-222
    4. Homo sapiens hsa-miR-222-3p
    5. Macaca mulatta mml-miR-222-3p
    6. Ornithorhynchus anatinus (platypus) oan-miR-222a-3p
    7. Pongo pygmaeus (Bornean orangutan) ppy-miR-222
    8. Rattus norvegicus rno-miR-222-3p
    9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
    10. Tupaia chinensis (Chinese tree shrew) tch-miR-222-3p
    11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3161177