v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-7 precursor (ppa-mir-7-1) URS00002C5007_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000016602.1)
  2. Gorilla gorilla gorilla ggo-mir-7-1 (ENSGGOG00000031191.2)
  3. Gorilla gorilla (western gorilla) microRNA ggo-mir-7 precursor (ggo-mir-7-1)
  4. Homo sapiens (human) microRNA hsa-mir-7 precursor (hsa-mir-7-1)
  5. Lagothrix lagotricha microRNA lla-mir-7 precursor
  6. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 7-1 (ENSNLEG00000023900.2)
  7. Oryctolagus cuniculus (rabbit) microRNA 7-1 (ENSOCUG00000025776.1)
  8. Pan troglodytes ptr-mir-7-1 (ENSPTRG00000027603.2)
  9. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000021883.1)
  10. Pongo abelii miRNA (ENSPPYG00000022346.2)
  11. Pongo pygmaeus microRNA ppy-mir-7 precursor (ppy-mir-7-1)
  12. Rhinopithecus bieti miRNA (ENSRBIG00000000797.1)
  13. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000018109.1)
 Publications