v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) microRNA 7-1 (ENSOCUG00000025776.1) URS00002C5007_9986

Automated summary: This pre miRNA sequence is 110 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-7, RF00053). Oryctolagus cuniculus (rabbit) microRNA 7-1 (ENSOCUG00000025776.1) sequence is a product of ENSOCUG00000025776.1 gene. Found in the Oryctolagus cuniculus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000016602.1)
    2. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-7-1 (ENSGGOG00000031191.2)
    3. Gorilla gorilla (western gorilla) microRNA ggo-mir-7 precursor (ggo-mir-7-1)
    4. Homo sapiens microRNA hsa-mir-7 precursor (hsa-mir-7-1)
    5. Lagothrix lagotricha microRNA lla-mir-7 precursor
    6. Nomascus leucogenys miRNA MIR7-1 (ENSNLEG00000023900.2)
    7. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-7 precursor (ppa-mir-7-1)
    8. Pan troglodytes ptr-mir-7-1 (ENSPTRG00000027603.2)
    9. Piliocolobus tephrosceles miRNA (ENSPTEG00000021883.1)
    10. Pongo abelii microRNA 7-1 (ENSPPYG00000022346.2)
    11. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-7 precursor (ppy-mir-7-1)
    12. Rhinopithecus bieti miRNA (ENSRBIG00000000797.1)
    13. Rhinopithecus roxellana miRNA (ENSRROG00000018109.1)