Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-7 precursor (hsa-mir-7-1) URS00002C5007_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR7-1: MIR7-1 is a microRNA precursor that is generated from HNRNPK intron 15 [PMC4647676]. Further research is needed to understand the genetic regulation and expression of MIR7-1, as well as its role in metabolic traits [PMC9522793]. MIR7-1 is located in the last intron of the HNRNPK gene, and its expression is driven by the promoter of HNRNPK [PMC9522793]. The transcription factor FOXP3 positively regulates miR-7 expression in breast cancer [PMC4600152]. miR-7 can be expressed from three loci in humans, including MIR7-1 [PMC4600152]. The exact mechanism of miR-7 stimulation via the PI3K/Akt pathway is still unknown, but c-Myc has been found to directly bind and stimulate expression from the MIR7-1 promoter [PMC4600152]. Other transcription factors, such as HOXD10 and HNF4α, have also been involved in promoting miR-7 expression via interaction with the promoter regions of miR-7 genes including MIR7-1 [PMC4600152]. MIR7-1 is believed to be the most highly expressed source of mature miR-7 and is located within the hnRNPK gene on chromosome 9 [PMC4600152]. In addition to its role in breast cancer, MIR7-1 has also been implicated in other diseases such as neurodegenerative alterations and metabolic alterations [PMC9571148].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Publications