v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-7 precursor (ppy-mir-7-1) URS00002C5007_9600

Automated summary: This pre miRNA sequence is 110 nucleotides long and is found in Pongo pygmaeus. Annotated by 2 databases (miRBase, ENA). Matches 1 Rfam family (mir-7, RF00053).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000016602.1)
    2. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-7-1 (ENSGGOG00000031191.2)
    3. Gorilla gorilla (western gorilla) microRNA ggo-mir-7 precursor (ggo-mir-7-1)
    4. Homo sapiens microRNA hsa-mir-7 precursor (hsa-mir-7-1)
    5. Lagothrix lagotricha microRNA lla-mir-7 precursor
    6. Nomascus leucogenys miRNA MIR7-1 (ENSNLEG00000023900.2)
    7. Oryctolagus cuniculus (rabbit) microRNA 7-1 (ENSOCUG00000025776.1)
    8. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-7 precursor (ppa-mir-7-1)
    9. Pan troglodytes ptr-mir-7-1 (ENSPTRG00000027603.2)
    10. Piliocolobus tephrosceles miRNA (ENSPTEG00000021883.1)
    11. Pongo abelii microRNA 7-1 (ENSPPYG00000022346.2)
    12. Rhinopithecus bieti miRNA (ENSRBIG00000000797.1)
    13. Rhinopithecus roxellana miRNA (ENSRROG00000018109.1)