Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-214-3p URS00002C11C3_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB, LncBase). Described in 46 papers. Mus musculus (house mouse) mmu-miR-214-3p sequence is a product of Mir214, mmu-miR-214-3p, mmu-miR-214, miR-214, miR-214-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (P)RR, 0610007M19Rik, 0610009E22Rik, 0610009K11Rik, 0610011C19Rik, 0610012J02Rik, 0610012K07Rik, 0610013D04Rik, 0610037K01Rik, 0610040D20Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACAGCAGGCACAGACAGGCAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-214-v1_3p (mature (guide))
    2. Anolis carolinensis aca-miR-214-3p
    3. Artibeus jamaicensis aja-miR-214
    4. Bos taurus bta-miR-214
    5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-214
    6. Canis lupus familiaris cfa-miR-214
    7. Cavia porcellus (domestic guinea pig) cpo-miR-214-3p
    8. Cervus elaphus cel-miR-214
    9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-214-v1_3p (mature (guide))
    10. Columba livia cli-miR-214-3p
    11. Dasypus novemcinctus dno-miR-214-3p
    12. Daubentonia madagascariensis dma-miR-214
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-214-v1_3p (mature (guide))
    14. Equus caballus (horse) eca-miR-214
    15. Gallus gallus (chicken) Gga-Mir-214-v1_3p (mature (guide))
    16. Homo sapiens (human) hsa-miR-214-3p
    17. Macaca mulatta Mml-Mir-214-v1_3p (mature (guide))
    18. Microcebus murinus mmr-miR-214
    19. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-214-v1_3p (mature (guide))
    20. Nomascus leucogenys nle-miR-214
    21. Ornithorhynchus anatinus (platypus) oan-miR-214-3p
    22. Oryctolagus cuniculus (rabbit) ocu-miR-214-3p
    23. Otolemur garnettii oga-miR-214
    24. Papio hamadryas (hamadryas baboon) pha-miR-214
    25. Pteropus alecto pal-miR-214-3p
    26. Python bivittatus pbv-miR-214-3p
    27. Rattus norvegicus Rno-Mir-214-v1_3p (mature (guide))
    28. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-214-v1_3p (mature (guide))
    29. Scyliorhinus torazame Sto-Mir-214-v1_3p (mature (guide))
    30. Taeniopygia guttata (zebra finch) tgu-miR-214-3p
    31. Tursiops truncatus miR-214
    32. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-214-v1_3p (mature (guide))