Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P2b_5p (mature (guide)) URS00002C10B3_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACCCGUAGAACCGACCUUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-99b
  2. Canis lupus familiaris (dog) cfa-miR-99b
  3. Capra hircus (goat) chi-miR-99b-5p
  4. Cavia porcellus cpo-miR-99b-5p
  5. Cervus elaphus cel-miR-99b
  6. Equus caballus eca-miR-99b
  7. Homo sapiens hsa-miR-99b-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-99b-5p
  9. Mus musculus (house mouse) mmu-miR-99b-5p
  10. Oryctolagus cuniculus Ocu-Mir-10-P2b_5p (mature (guide))
  11. Otolemur garnettii oga-miR-99b
  12. Ovis aries (sheep) miscellaneous RNA
  13. Pan troglodytes ptr-miR-99b
  14. Pteropus alecto pal-miR-99b-5p
  15. Rattus norvegicus (Norway rat) rno-miR-99b-5p
  16. Sus scrofa ssc-miR-99b
  17. Tupaia chinensis tch-miR-99b-5p