Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-671 URS00002B7450_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCGGUUCUCAGGGCUCCACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Artibeus jamaicensis aja-miR-671
  2. Bos taurus Bta-Mir-671_3p (mature (guide))
  3. Canis lupus familiaris (dog) cfa-miR-671
  4. Capra hircus chi-miR-671-3p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-671-3p
  6. Cervus elaphus (red deer) cel-miR-671
  7. Cricetulus griseus (Chinese hamster) cgr-miR-671-3p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-671-3p
  9. Echinops telfairi Ete-Mir-671_3p (mature (co-guide))
  10. Equus caballus (horse) eca-miR-671-3p
  11. Gorilla gorilla gorilla ggo-miR-671 (MIR671)
  12. Gorilla gorilla (western gorilla) ggo-miR-671
  13. Homo sapiens (human) hsa-miR-671-3p
  14. Macaca mulatta (Rhesus monkey) mml-miR-671-3p
  15. Mus musculus (house mouse) mmu-miR-671-3p
  16. Oryctolagus cuniculus (rabbit) ocu-miR-671-3p
  17. Pan troglodytes ptr-miR-671
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-671-3p
  19. Rattus norvegicus (Norway rat) rno-miR-671
  20. Sus scrofa ssc-miR-671-3p