Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-671-3p URS00002B7450_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-671: Hsa-mir-671 is a microRNA that has been found to be upregulated in certain conditions. In a study, it was identified as one of the upregulated microRNAs in a network analysis of differentially expressed circRNAs, miRNAs, and hub genes [PMC9282983]. Another study found that hsa-mir-671 was one of the five pre-miRNA hairpins that contained inhibited RNA motifs and were included in a larger set of pre-miRNA hairpins [PMC9594041]. However, it was also observed that hsa-mir-671 levels did not change upon c-Myc induction [PMC6018428]. In another analysis, hsa-mir-671 was identified as one of the miRNAs frequently targeted at detected spliced transcripts [PMC3652308]. Furthermore, hsa-mir-671 has been selected for GO enrichment analysis in hepatocellular carcinoma (HCC) due to its high fold change [PMC3565310]. It has also been included in RT reactions for amplification along with other miRs [PMC8533892]. In silico prediction analysis revealed that InsR and IGFR1 were common targets of hsa-mir-671 along with other microRNAs [PMC5728069]. Additionally, hsa-mir-671 was found to be expressed in multiple tumors along with other microRNAs such as hsa-miR-17 and hsa-miR-106b [PMC6306400]. Lastly, it was observed that hsa-mir-671 positively regulates the proliferation of smooth muscle cells [PMC4222264].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCGGUUCUCAGGGCUCCACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Artibeus jamaicensis aja-miR-671
  2. Bos taurus Bta-Mir-671_3p (mature (guide))
  3. Canis lupus familiaris (dog) cfa-miR-671
  4. Capra hircus chi-miR-671-3p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-671-3p
  6. Cervus elaphus (red deer) cel-miR-671
  7. Cricetulus griseus (Chinese hamster) cgr-miR-671-3p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-671-3p
  9. Echinops telfairi Ete-Mir-671_3p (mature (co-guide))
  10. Equus caballus (horse) eca-miR-671-3p
  11. Gorilla gorilla gorilla ggo-miR-671 (MIR671)
  12. Gorilla gorilla (western gorilla) ggo-miR-671
  13. Macaca mulatta (Rhesus monkey) mml-miR-671-3p
  14. Mus musculus (house mouse) mmu-miR-671-3p
  15. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-671
  16. Oryctolagus cuniculus (rabbit) ocu-miR-671-3p
  17. Pan troglodytes ptr-miR-671
  18. Pongo pygmaeus (Bornean orangutan) ppy-miR-671-3p
  19. Rattus norvegicus (Norway rat) rno-miR-671
  20. Sus scrofa ssc-miR-671-3p
Publications