Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-671-3p URS00002B7450_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (TarBase, GeneCards, ENA, miRBase, MirGeneDB, MalaCards, LncBase, RefSeq). Homo sapiens (human) hsa-miR-671-3p sequence is a product of MIR671, hsa-miR-671-3p, miR-671, hsa-miR-671, miR-671-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2A9, 90K, A2D, A2lp, AADACL1, ADAM-TS7, ADAMTS7, ALDH18A1, ALKBH9, ALL-1.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCCGGUUCUCAGGGCUCCACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Artibeus jamaicensis aja-miR-671
    2. Bos taurus Bta-Mir-671_3p (mature (guide))
    3. Canis lupus familiaris cfa-miR-671
    4. Capra hircus chi-miR-671-3p
    5. Cavia porcellus cpo-miR-671-3p
    6. Cervus elaphus (red deer) cel-miR-671
    7. Cricetulus griseus (Chinese hamster) cgr-miR-671-3p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-671-3p
    9. Echinops telfairi Ete-Mir-671_3p (mature (co-guide))
    10. Equus caballus (horse) eca-miR-671-3p
    11. Gorilla gorilla (western gorilla) ggo-miR-671
    12. Macaca mulatta (Rhesus monkey) mml-miR-671-3p
    13. Mus musculus (house mouse) mmu-miR-671-3p
    14. Nomascus leucogenys nle-miR-671
    15. Oryctolagus cuniculus ocu-miR-671-3p
    16. Pan troglodytes (chimpanzee) ptr-miR-671
    17. Pongo pygmaeus ppy-miR-671-3p
    18. Rattus norvegicus (Norway rat) rno-miR-671
    19. Sus scrofa ssc-miR-671-3p
    Publications New