Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-92a precursor (hsa-mir-92a-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-92a precursor (hsa-mir-92a-1) URS00002B6637_9606

  • 78 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 43 species

Automated summary: This pre miRNA sequence is 78 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, miRBase, HGNC, MalaCards, Rfam, Ensembl/GENCODE, ENA, GeneCards, Ensembl). Described in 53 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-92, RF00464). Homo sapiens (human) microRNA hsa-mir-92a precursor (hsa-mir-92a-1) sequence is a product of mir-92a-1 precursor, 1, miR-92-precursor-13, mir-92a-1, 92-precursor-13 micro RNA, 92-precursor-13, MIR92A1, 92 microRNA precursor family, 92 microRNA precursor famil, miR-92-precursor-13 micro RNA, hsa-mir-92a-1 precursor, 92-precursor-13 micro RN, mir-92a-1 precurso, mir-92 microRNA precursor family, 92a-1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Ailuropoda melanoleuca mir-92 microRNA precursor family
    2. Aotus nancymaae miRNA
    3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-92 precursor (age-mir-92-1)
    4. Bos taurus microRNA bta-mir-92a precursor (bta-mir-92a-1)
    5. Callithrix jacchus mir-92 microRNA precursor family
    6. Camelus ferus mir-92 microRNA precursor family
    7. Canis lupus familiaris mir-92 microRNA precursor family
    8. Carlito syrichta (Philippine tarsier) miRNA
    9. Cavia porcellus microRNA 92a-1
    10. Cercocebus atys (Sooty mangabey) miRNA
    11. Chinchilla lanigera (Long-tailed chinchilla) miRNA
    12. Chlorocebus sabaeus mir-92 microRNA precursor family
    13. Colobus angolensis palliatus miRNA
    14. Equus caballus mir-92 microRNA precursor family
    15. Felis catus mir-92 microRNA precursor family
    16. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-92-1
    17. Gorilla gorilla microRNA ggo-mir-92 precursor (ggo-mir-92-1)
    18. Heterocephalus glaber miRNA
    19. Ictidomys tridecemlineatus miRNA
    20. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-92 precursor (lla-mir-92-1)
    21. Lemur catta (Ring-tailed lemur) microRNA lca-mir-92 precursor (lca-mir-92-1)
    22. Macaca fascicularis (Crab-eating macaque) miRNA
    23. Macaca mulatta microRNA mml-mir-92a precursor (mml-mir-92a-1)
    24. Macaca nemestrina miRNA
    25. Mandrillus leucophaeus (Drill) miRNA
    26. Marmota monax non-coding RNA
    27. Microcebus murinus miRNA
    28. Otolemur garnettii mir-92 microRNA precursor family
    29. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-92a precursor (ppa-mir-92a-1)
    30. Panthera pardus microRNA 92a-1
    31. Panthera tigris altaica (Tiger) miRNA
    32. Pan troglodytes (chimpanzee) microRNA ptr-mir-92 precursor (ptr-mir-92-1)
    33. Papio anubis (Olive baboon) miRNA
    34. Pongo pygmaeus (Bornean orangutan) precursor microRNA mir-92-1
    35. Propithecus coquereli (Coquerel's sifaka) miRNA
    36. Pteropus alecto mir-92 microRNA precursor family
    37. Pteropus vampyrus miRNA
    38. Rhinopithecus bieti miRNA
    39. Rhinopithecus roxellana miRNA
    40. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-92 precursor (sla-mir-92-1)
    41. Saimiri boliviensis boliviensis miRNA
    42. Sus scrofa mir-92 microRNA precursor family
    43. Tursiops truncatus (bottlenosed dolphin) miRNA
    44. Vicugna pacos (alpaca) miRNA
    2D structure New