v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Theobroma cacao (cacao) tcc-miR171a URS00002B5799_3641

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAUUGAGCCGCGCCAAUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Amborella trichopoda atr-miR171c
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR171a-3p
  3. Arabidopsis thaliana ath-miR171a-3p
  4. Brachypodium distachyon (stiff brome) bdi-miR171a
  5. Brassica napus (rape) bna-miR171f
  6. Brassica rapa bra-miR171e
  7. Citrus x clementina (clementine) ccl-miR171
  8. Corchorus capsularis (jute) sRNA CCACVL1_01262
  9. Cucumis melo cme-miR171a
  10. Malus domestica (apple) mdm-miR171c
  11. Oryza sativa (Asian cultivated rice) osa-miR171a
  12. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR171a
  13. Sorghum bicolor sbi-miR171j
  14. Vitis vinifera vvi-miR171e
  15. Zea mays (maize) zma-miR171n-3p