Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata aly-miR171a-3p URS00002B5799_59689

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Arabidopsis lyrata. Annotated by 2 databases (ENA, miRBase). Arabidopsis lyrata aly-miR171a-3p sequence is a product of aly-miR171a, aly-miR171a-3p, miR171, miR171a-3p, miR171a genes. Found in the Arabidopsis lyrata reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAUUGAGCCGCGCCAAUAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 121 other species

    1. Amborella trichopoda atr-miR171a
    2. Arabidopsis thaliana (thale cress) ath-miR171a-3p
    3. Brachypodium distachyon (stiff brome) bdi-miR171a
    4. Brassica napus bna-miR171f
    5. Brassica rapa (field mustard) bra-miR171e
    6. Citrus clementina ccl-miR171
    7. Corchorus capsularis (jute) sRNA CCACVL1_01262
    8. Cucumis melo cme-miR171a
    9. Malus domestica (apple) mdm-miR171d
    10. Oryza sativa Japonica Group microRNA osa-miR171a
    11. Oryza sativa osa-miR171a
    12. Sorghum bicolor sbi-miR171j
    13. Theobroma cacao tcc-miR171a
    14. Vitis vinifera (wine grape) vvi-miR171e
    15. Zea mays zma-miR171n-3p
    Publications New