Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-20b-5p URS00002B3783_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 9 databases (RefSeq, TarBase, PSICQUIC, MirGeneDB, ENA, miRBase, LncBase, PirBase, IntAct). Described in 36 papers. Mus musculus (house mouse) mmu-miR-20b-5p sequence is a product of miR-20b, miR-20, mmu-miR-20b-5p, Mir20b, mmu-miR-20b, miR-20b-5p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007L03Rik, 0610010B06Rik, 0610011D08Rik, 0610011K02Rik, 0610011L13Rik, 0610012D17Rik, 0610016I07Rik, 0610016L08Rik, 0610020I02Rik, 0610027D24Rik.

Interactions 7

According to PSICQUIC and IntAct, Mus musculus (house mouse) mmu-miR-20b-5p interacts with:

Interaction id Participant Synonyms
EBI-27027536 intact:EBI-27027610 EBI-27027610 ENSMUST00000030884 mrna_mfn2-1
URS00002B3783_10090-3 A2CG63 A2CG63
URS00002B3783_10090-0 A2CG63 A2CG63
URS00002B3783_10090-1 Q8BM54 Q8BM54
URS00002B3783_10090-4 Q8BM54 Q8BM54
URS00002B3783_10090-5 Q9ERH7 Q9ERH7
URS00002B3783_10090-2 Q9ERH7 Q9ERH7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAAAGUGCUCAUAGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Anolis carolinensis Aca-Mir-17-P3b_5p (mature (guide))
    2. Callithrix jacchus cja-miR-20b
    3. Callorhinchus milii (elephant shark) eshark_mir-17_5
    4. Capra hircus miR-20b
    5. Chrysemys picta bellii Cpi-Mir-17-P3b_5p (mature (guide))
    6. Columba livia (rock pigeon) cli-miR-20b-5p
    7. Cricetulus griseus cgr-miR-20b
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-20b-5p
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-17-P3b_5p (mature (guide))
    10. Equus caballus (horse) eca-miR-20b
    11. Gallus gallus (chicken) gga-miR-20b-5p
    12. Gorilla gorilla (western gorilla) ggo-miR-20b
    13. Homo sapiens hsa-miR-20b-5p
    14. Macaca mulatta mml-miR-20b-5p
    15. Monodelphis domestica mdo-miR-20b-5p
    16. Ornithorhynchus anatinus oan-miR-20b-5p
    17. Oryctolagus cuniculus (rabbit) Ocu-Mir-17-P3b_5p (mature (guide))
    18. Ovis aries miscellaneous RNA
    19. Pan troglodytes (chimpanzee) ptr-miR-20b
    20. Pongo pygmaeus ppy-miR-20b
    21. Pteropus alecto pal-miR-20b-5p
    22. Python bivittatus pbv-miR-20b-5p
    23. Rattus norvegicus rno-miR-20b-5p
    24. Sarcophilus harrisii Sha-Mir-17-P3b_5p (mature (guide))
    25. Taeniopygia guttata (zebra finch) tgu-miR-20b-5p
    26. Xenopus laevis (African clawed frog) xla-miR-20
    27. Xenopus tropicalis xtr-miR-20b