v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2068 (LINC02068) URS00002B2A0E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02068: LINC02068 is a long non-coding RNA (lncRNA) that has been identified in various studies [PMC9131284]. It has been found to be shared between ILN (naive) and CLN (CD69–) clones [PMC7605534]. Additionally, LINC02068 has shown an upregulation pattern dependent on the SARS-CoV-2 viral load [PMC9131284]. In the context of endometrial cancer, high expression of LINC02068 is associated with poor prognosis [PMC7960070]. It is one of the risk-associated genes in a signature that includes B3GAT2, CD3EAP, FRMPD3, LINC01224, LY6H, and NR6A1 [PMC7960070]. The expression of these risk-associated genes increases with an increasing risk score [PMC7960070]. On the other hand, DMC1 and TLE2 are protective genes in this context [PMC7960070]. References: - [PMC7605534]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7605534/ - [PMC9131284]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9131284/ - [PMC7960070]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7960070/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCAAUUCAAAAACUUAUCUAAAACAUGUAAUUACUGGGAAAUUCCAGAUUAAUUUCCUGCAAGUUUUAGUUAGUUAACGAUUGUGUUAAACACUUAAGAGAGCAGCUCCUAGAUGACUAAACCUGCUCAGCUGAAAUCAAAUGCUCUCAUGCUUCCCUGAAUGGACACACACAGAGUCUCUUCACCUGAGGAAUAAAGUGUAAGAUCUUCAGAACUUUUAUUCAGGGGAGAAAGGCCCAGGUAGCUGCUGCUGUUCAGCUUAAGGCUAAUCUGACCUUCUAUAACAGGAGUUCAAGUCCCAGAAAUCCCUAGUCCUCCAUCAGAGGCUUCACUCAUUACAGGAGAAGAGAGUCUGGGUUGCUCCCUCAUCAAUCAAGUGCAGAGUCCAGGAAGGGAGAGGCGGGCAGUAACGUGCAUGGAGCUGUCACCUCCUAUGACAACAACACCUUCUGGAAUACCUCCUGAAGGACACGCCUGAGGAUGUUUUACAGUUAACUUUUUAAAAAAUACAUAAGUAGAAAGAGAACACUCUAAAAUAAAAAUAAAAGGUAUAGUAUAAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications