Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-654-5p URS00002B0B46_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-654: Hsa-mir-654 is a microRNA that has been found to have positive correlations with various variables, including FA (16:0), FA (20:2), FA (18:0), FA (18:2), FA (20:3), and FA (20:4) [PMC8698767]. However, some miRNAs from this list were not human or were not detected, and from the remaining miRNAs, 11 were identified as differentially expressed in GA [PMC6888638]. Hsa-mir-654 has also been associated with overall survival in head and neck squamous cell carcinoma (HNSCC) [PMC5008307]. In a study, a six microRNA signature including hsa-mir-654 was identified as an independent predictor for HNSCC patient survival [PMC5008307]. On the other hand, hsa-mir-654 was not found in upregulated human miRNA data but was downregulated in viral infections [PMC9493126]. In glioblastoma multiforme (GBM), hsa-mir-654 was found to be a protective miRNA associated with clinical outcomes [PMC3917617]. Overall, hsa-mir-654 has been implicated in various biological processes and diseases, highlighting its potential as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUGGGCCGCAGAACAUGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-654 (MIR654)
  2. Gorilla gorilla (western gorilla) ggo-miR-654
  3. Macaca mulatta mml-miR-654-5p
  4. Pongo pygmaeus ppy-miR-654-5p
Publications