Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) epigenetically induced MYC interacting lncRNA 1 (EPIC1) URS00002B0998_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

EPIC1: EPIC1 is a type of long non-coding RNA that has been studied in various contexts. One study found that upregulation of EPIC1 promoted cell survival and targeted Myc, while silencing EPIC1 exacerbated cytotoxicity induced by Dex [PMC7691603]. Another study focused on EPIC1 and EPIC2B from the oomycete Phytophthora infestans [PMC7317818]. In glioma cells, the full length of EPIC1 was introduced using lentiviruses, and Cdc20 siRNA was transfected to investigate its effects [PMC7163045]. Pathway analysis of RNA-seq data from EPIC1 knockdown revealed that the enhancer of zeste homolog 2 (EZH2) targets were enriched in differentially expressed genes after knockdown [PMC7875530]. In breast cancer, there have been limited clinical studies on the predictive value of EPIC1 for neoadjuvant chemotherapy. One study found that patients with high expression of EPIC1 were more likely to be HER2 positive and have a higher histologic grade compared to patients with low expression [PMC7383657]. Overall, these studies highlight the diverse roles and potential clinical significance of EPIC1 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUUGGGGAGGGGCCAGCUGCUGUGUUCAGUCCGCCAUUGCAAACACGAAGCUCUUCCAGAAACGCCCUCACAGACACCCCGGAAGUCACGUACCCACUCUGUAGGUGCCCCGGGGCACAGGCAAGCGGACGAGCCAGUUAUCCCUCAGAGCUCCUGCUGCCUCGCCCGCUUUCUCUCGGAAACGUGAAGUGUGGCCUCAGCUGAAAGUGAGGUGGGCCUCAUUCAAUCAGUUGAAUUCUUCAAGAGAGAAAAACUGAAGUCCCUUAGAAGGAAAGAGUUCUGCCUUCAGACUGUCUUUGAACUUAAGACUGUAGCGUCGACUCCUGCCGGAAUUUCCAGCCUGCUGGCCAGCUCUGCAGAUUCACACUUGCCAGCCUCCACAAUCGCAGCUGAGGCGGAGGAACCCUAAGGGCUCAUUGAGAUCAUGGAUUUGCCCUUCUAUGCAUUGAUGGAGCACCUGCUGCCCACAGCGUCUGUAUUUGGUGCUGGGAUGCUGAGGACACUGAGAUCUUCAAACAGAGGCUGCCACUCUAAGCAAACAGAUCCCGAGCCCUGGACUCUGAAGCUUGGGCCCAGUUCUCCUUUUCUCCGGGUUUCAGAUCCCACUGUGAAGUGAGGGGGCCCUUCUGAUUCAGGACCCGGGGAAGCCAGGGGCAUGAGCAUCGGUGCCUCUUCUCUAUUUCAAGGACCCUUCUGGGUGUAAAGUUCUCUGAGAUGCCUUACAUGGAUUCCCACCACUGCAAGAUAACCAUCGUAUGUAAAGUGUUAUGACCAGCAGAGCGUAAUUGAAGUGCAUUCCAGAGGGAAAGACAGCGGCUCAGAUGAGGCUUCAGGCUUGACCAAAUCUGACUGGCUGGCUGCCGGAGACACUGCUACCCAUCGGCCCUUAAUAAAUGGCCUCAUUUGAUCAUCAUGUGAUCUUCAGAAGCUGGGCUUGAUUAUCCUUGCCAAACAAAAUGCUGAAACCAAAAAUCUGAAAGUAAAUCAAAGGUUUCGCCAUCAUGUAAACCCUUGGGCGACAGAGUCUACCUGUCUCCCCCUGAUAUUGUUCUAUGAGAUUUCGAUGCUAUCUUCAUUGCCAGCAGCCCUGACAAAGAUGCACUGCAGACGGAUAGCCUCUCAGGAACCUGCUUACCUCAGAGCCUGCUGCGGACUGAGUUGUCUUCUCCAAAAUCCAUUUGUGGAGGCCCUCAUCCCCAGUGGGAGAGUAUUUGGAGAUGAAGCAUUUGGAGGUGAUUAAGCUUAGAUGAGCUCAGAGUGGAGCCUCAGGAUGGCAUCGAUGCCCUGGUAAAGAGGGACACUGAGACCUGGCCCUCCCUUGCUCUCCACCGUGUGAGGACACAAUGAGAUGGUGGCCACCUACAAGCCAGGAACUGAACCCUACGGGGCCUUGACACUGGCCGUUCCAGCCUCCAGAAUGGCUAGGAAUAAAUGUCUGCUCUUUAAGUCACUGGGCGGUGGAGCUUUGUUAUGGCAGCACCAGGGGCUGGUUGAGAGCCUUUGCAUGGCUCUUGUUCCACCUGGAAUGAGAUUUCUAACUCUUGGCUACCUCACCCCCUUACCUCAUUGUUUCAUGUUGCAACCACCCACCCACUCCCCAUGUCUCUGGCAUUCUCAUUUAUUUUUUCUUUGAUUUCAUAGAACACAUCACAAAGCCAUUUGCUCAUGCAUGAUGUUUAUUGUCUAUUUUCUAUCUCCCUGCUAGAGGGUAAGAUGCUCAAGAACACUGCUCUGUCUGCCUCCCUGGACCCAGAAAAUGCUUGGCGUGUGGUAGAACUUAGAUAUAUUUGUGUUGAAUAAAUUAAUUGAAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications